Quick Order

Human PPIB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPIB cDNA Clone Product Information
Gene_bank_ref_id:NM_000942.4
RefSeq ORF Size:651bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidylprolyl isomerase B (cyclophilin B).
Gene Synonym:CYPB, SCYLP, CYP-S1, MGC2224, MGC14109
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PPIB
Restriction Site:KpnI + NotI (6.1kb + 0.65kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG11004-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"