After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Integrin beta2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITGB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_000211.3
RefSeq ORF Size:2310bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit).
Gene Synonym:LAD, CD18, MF17, MFI7, LCAMB, LFA-1, MAC-1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGB2
Restriction Site:KpnI + XbaI (6.1kb + 2.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 24 G>T, 819 G>A and 1323 T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB2 Gene Plasmid Map
Human Integrin beta2 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG10970-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"