Quick Order

Human Serum Albumin / HSA / ALB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALB cDNA Clone Product Information
Gene_bank_ref_id:NM_000477.5
RefSeq ORF Size:1830bp
cDNA Description:Full length Clone DNA of Homo sapiens albumin.
Gene Synonym:PRO0883, PRO0903, PRO1341, DKFZp779N1935, ALB
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ALB
Restriction Site:KpnI + NotI (6.1kb + 1.83kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 135 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10968-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"