After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GDF-15 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GDF15cDNA Clone Product Information
cDNA Size:927
cDNA Description:ORF Clone of Homo sapiens growth differentiation factor 15 DNA.
Gene Synonym:PDF, MIC1, PLAB, MIC-1, NAG-1, PTGFB, GDF-15
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites

Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items