Quick Order

Text Size:AAA

Human HIST3H2A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HIST3H2A cDNA Clone Product Information
Gene_bank_ref_id:NM_033445.2
RefSeq ORF Size:393bp
cDNA Description:Full length Clone DNA of Homo sapiens histone cluster 3, H2a.
Gene Synonym:MGC3165,
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • Size / Price
    Catalog: HG10926-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"