After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human OSTM1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OSTM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014028.3
RefSeq ORF Size:1005bp
cDNA Description:Full length Clone DNA of Homo sapiens osteopetrosis associated transmembrane protein 1.
Gene Synonym:GL, GIPN, OPTB5, HSPC019,
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I  membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).

References

1.  Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2.  Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3.  Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4.  Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5.  Feigin, ME.et al., 2008, Cell Signal. 20 (5): 949-957.  

6.  Pata, M.et al., 2008, J Biol Chem. 283 (45): 30522-30530. 

Size / Price
Catalog: HG10913-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"