After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human FGF21 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGF21cDNA Clone Product Information
cDNA Size:630
cDNA Description:ORF Clone of Homo sapiens fibroblast growth factor 21 DNA.
Gene Synonym:FGF21
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Cynomolgus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGF21 Protein (His Tag)Human FGFBP3 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinHuman FGF18 / FGF-18 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Cynomolgus FGFR3 Protein (Fc Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Canine aFGF / FGF1 ProteinCanine FGF12 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)

Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

  • Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.
  • Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.
  • Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items