Quick Order

Human CCL4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL4 cDNA Clone Product Information
Gene_bank_ref_id:NM_002984.2
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 4.
Gene Synonym:ACT2, G-26, LAG1, MIP1B, SCYA2, SCYA4, MIP1B1, AT744.1, MGC104418, MGC126025, MGC126026, MIP-1-beta
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCL4
Restriction Site:KpnI + XbaI (6.1kb + 0.28kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: HG10899-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"