Quick Order

Human ECE-1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ECE1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001397.2
RefSeq ORF Size:2313bp
cDNA Description:Full length Clone DNA of Homo sapiens endothelin converting enzyme 1.
Gene Synonym:ECE, ECE1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ECE1
Restriction Site:KpnI + XbaI (6.1kb + 2.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ECE1 Gene Plasmid Map
Human ECE-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type I I membrane protein which belongs to the peptidase M13 family. ECE-1 converts big endothelin-1 to endothelin-1. ECE-1 is a membrane metalloprotease that generates endothelin from its direct precursor big endothelin. Four isoforms of ECE-1 are produced from a single gene through the use of alternate promoters. These isoforms share the same extracellular catalytic domain and contain unique cytosolic tails, which results in their specific subcellular targeting.All isoforms of ECE-1 are expressed in umbilical vein endothelial cells, polynuclear neutrophils, fibroblasts, atrium cardiomyocytes and ventricles. Isoforms A, B and C of ECE-1 are also expressed in placenta, lung, heart, adrenal gland and phaeochromocytoma; isoforms A and C of ECE-1 in liver, testis and small intestine; isoform B, C and D of ECE-1 in endothelial cells and umbilical vein smooth muscle cells; isoforms C and D in saphenous vein cells, and isoform C in kidney. Defects in ECE1 are a cause of Hirschsprung disease, cardiac defects and autonomic dysfunction. It is a form of Hirschsprung disease with skip-lesions defects, craniofacial abnormalities and other dysmorphic features, and autonomic dysfunction.

Size / Price
Catalog: HG10887-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"