After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human METAP1D / MAP1D natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human METAP1D cDNA Clone Product Information
Gene_bank_ref_id:NM_199227.1
RefSeq ORF Size:1008bp
cDNA Description:Full length Clone DNA of Homo sapiens methionine aminopeptidase 1D.
Gene Synonym:AT4G37040, METHIONINE
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAP1D
Restriction Site:HindIII + XbaI (6.1kb + 1.01kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human METAP1D Gene Plasmid Map
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Methionine aminopeptidase 1D, also known as MAP1D, is a member of the peptidase M24A family. N-terminal methionine removal is an important cellular process required for proper biological activity, subcellular localization, and eventual degradation of many proteins. The enzymes that catalyze this reaction are called Methionine aminopeptidases (MAPs). MAP1D is overexpressed in colon cancer cell lines and colon tumors as compared to normal tissues (at protein level). Downregulation of MAP1D expression by shRNA in HCT-116 colon carcinoma cells reduces anchorage-independant growth in soft agar. MAP1D binds two cobalt ions per subunit. The true nature of the physiological cofactor is under debate. MAP1D is also active with zinc, manganese or divalent ions. MAP1D removes the amino-terminal methionine from nascent proteins. It may also play an important role in colon tumorigenesis.

Size / Price
Catalog: HG10883-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"