Quick Order

Text Size:AAA

Human CXCL14 / BRAK natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CXCL14 cDNA Clone Product Information
NCBI RefSeq:NM_004887.4
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 14.
Gene Synonym:KS1, Kec, BMAC, BRAK, NJAC, MIP-2g, SCYB14, MGC10687, bolekine, CXCL14
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CXCL14
Restriction Site:HindIII + XbaI (6.1kb + 0.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CXCL14 Gene Plasmid Map
Human CXCL14 / BRAK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: HG10880-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"