Quick Order

Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HDAC8cDNA Clone Product Information
cDNA Size:1134
cDNA Description:ORF Clone of Homo sapiens histone deacetylase 8 DNA.
Gene Synonym:RPD3, HDACL1
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 6 G/A not
causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10864-ACG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10864-ACR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10864-ANG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10864-ANR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10864-CF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10864-CH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10864-CM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10864-CY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone)HG10864-M$95
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10864-M-F$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-M-N$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10864-NF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10864-NH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10864-NM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10864-NY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items