Quick Order

Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
YWHAHcDNA Clone Product Information
cDNA Size:741
cDNA Description:ORF Clone of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide DNA.
Gene Synonym:YWHA1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10847-ACG$325
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10847-ACR$325
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10847-ANG$325
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10847-ANR$325
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10847-CF$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10847-CH$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10847-CM$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10847-CY$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone)HG10847-M$95
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10847-M-F$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10847-M-N$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10847-NF$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10847-NH$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10847-NM$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10847-NY$295
Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10847-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
  • Wakui H, et al. (1997) Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem. 272(13): 8153-6.
  • Toyooka K, et al. (2002) Isolation and structure of the mouse 14-3-3 eta chain gene and the distribution of 14-3-3 eta mRNA in the mouse brain. Brain Res Mol Brain Res. 100(1-2): 13-20.
  • Kim YS, et al. (2005) Role of 14-3-3 eta as a positive regulator of the glucocorticoid receptor transcriptional activation. Endocrinology. 146(7): 3133-40.
  • Grover D, et al. (2009) Family-based association of YWHAH in psychotic bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 150B(7): 977-83.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged