Quick Order

Text Size:AAA

Human YWHAQ natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human YWHAQ cDNA Clone Product Information
Gene_bank_ref_id:NM_006826.2
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide.
Gene Synonym:1C5, HS1, 14-3-3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-YWHAQ
Restriction Site:HindIII + XbaI (6.1kb + 0.74kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • Size / Price
    Catalog: HG10845-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"