After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KYNU / Kynureninase natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KYNU cDNA Clone Product Information
Gene_bank_ref_id:NM_003937.2
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Homo sapiens kynureninase (L-kynurenine hydrolase).
Gene Synonym:KYNU
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Lima S, et al. (2007) Crystal structure of Homo sapiens kynureninase. Biochemistry. 46(10): 2735-44.
  • Momany C, et al. (2004) Three-dimensional structure of kynureninase from Pseudomonas fluorescens. Biochemistry. 43(5): 1193-203.
  • Toma S, et al. (1997) Cloning and recombinant expression of rat and human kynureninase. FEBS Lett. 408(1): 5-10.
  • Size / Price
    Catalog: HG10841-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"