After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SIRT2 transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SIRT2 cDNA Clone Product Information
Gene_bank_ref_id:NM_030593.1
RefSeq ORF Size:1059bp
cDNA Description:Full length Clone DNA of Homo sapiens sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae), transcript variant 2.
Gene Synonym:SIR2, SIR2L, SIR2L2, SIRT2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SIRT2
Restriction Site:HindIII + XbaI (6.1kb + 1.06kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10830-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"