Quick Order

Human Lyn Kinase transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LYN cDNA Clone Product Information
Gene_bank_ref_id:NM_001111097.1
RefSeq ORF Size:1476bp
cDNA Description:Full length Clone DNA of Homo sapiens v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2.
Gene Synonym:JTK8, FLJ26625, LYN
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Tyrosine-protein kinase Lyn is a member of the Src family of protein tyrosine kinases, which is mainly expressed in hematopoietic cells, in neural tissues liver, and adipose tissue. Tyrosine-protein kinase Lyn has many functions. Lyn kinase may down regulate expression of stem cell growth factor receptor (KIT). Lyn kinase Acts as an effector of EpoR (erythropoietin receptor) in controlling KIT expression and may play a central role in erythroid differentiation during the switch between proliferation and maturation. Lyn kinase also acts as a positive regulator of cell movement while negatively regulating adhesion to stromal cells by inhibiting the ICAM-1-binding activity of beta-2 integrins. Lyn kinase relays suppressing signals from the chemokine receptor CXCR4 to beta-2 integrin LFA-1 in hematopoietic precursors. This kinase is Involved in induction of stress-activated protein kinase (SAPK), but not ERK or p38 MAPK, in response to genotoxic agents. In a word, Lyn kinase functions primarily as negative regulator, but can also function as activator, depending on the context. Tyrosine-protein kinase Lyn Required for the initiation of the B-cell response, but also for its down-regulation and termination. It also Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. It has been reported that Lyn kinase plays a role in the inflammatory response to bacterial lipopolysaccharide. Lyn kinase Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils.

References
  • Grishin A V, et al. (2001) Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis. Proc Natl Acad Sci U.S.A. 98 (18): 10172-7.
  • Hayashi T, et al. (1999) The AMPA receptor interacts with and signals through the protein tyrosine kinase Lyn. Nature. 397(6714): 72-6.
  • Ptasznik A, et al. (2004) Short interfering RNA (siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+) leukemia cells. Nat Med. 10(11): 1187-9.
  • Size / Price
    Catalog: HG10829-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"