After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Integrin alpha L natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITGAL cDNA Clone Product Information
NCBI RefSeq:NM_002209.2
RefSeq ORF Size:3513bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide).
Gene Synonym:CD11A, LFA-1, LFA1A, ITGAL
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGAL
Restriction Site:KpnI + XbaI (6.1kb + 3.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2928 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGAL Gene Plasmid Map
Human Integrin alpha L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10812-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"