After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCL4L1 / LAG-1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL4L1 cDNA Clone Product Information
Gene_bank_ref_id:NM_207007.3
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 4-like 1.
Gene Synonym:LAG1, CCL4L, LAG-1, SCYA4L, AT744.2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCL4L1
Restriction Site:KpnI + XbaI (6.1kb + 0.28kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 222 C/T, 228 C/T and 237 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: HG10798-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"