After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PKC delta / PRKCD natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKCD cDNA Clone Product Information
Gene_bank_ref_id:NM_006254.3
RefSeq ORF Size:2031bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase C, delta.
Gene Synonym:MAY1, PKCD, MGC49908, nPKC-delta
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Size / Price
    Catalog: HG10769-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"