Quick Order

Human MASTL / THC2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MASTL cDNA Clone Product Information
Gene_bank_ref_id:NM_032844.2
RefSeq ORF Size:2637bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule associated serine/threonine kinase-like.
Gene Synonym:THC2, FLJ14813, RP11-85G18.2, MASTL
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MASTL
Restriction Site:HindIII + NotI (6.1kb + 2.64kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1782 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MASTL Gene Plasmid Map
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10761-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"