Quick Order

Text Size:AAA

Human MICB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MICBcDNA Clone Product Information
Gene_bank_ref_id:NM_005931.2
cDNA Size:1152
cDNA Description:ORF Clone of Homo sapiens MHC class I polypeptide-related sequence B DNA.
Gene Synonym:PERB11.2, MICB
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

References
  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Size / Price
    Catalog:HG10759-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human MICB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"