After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRKCB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKCB cDNA Clone Product Information
Gene_bank_ref_id:NM_002738.6
RefSeq ORF Size:2022bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase C, beta.
Gene Synonym:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PRKCB
Restriction Site:KpnI + XbaI (6.1kb + 2.02kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10750-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"