After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FASTKcDNA Clone Product Information
Gene_bank_ref_id:NM_006712.3
cDNA Size:1650
cDNA Description:ORF Clone of Homo sapiens Fas-activated serine/threonine kinase DNA.
Gene Synonym:FAST, FASTK
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10737-ACG$345
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10737-ACR$345
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10737-ANG$345
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10737-ANR$345
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10737-CF$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10737-CH$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10737-CM$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10737-CY$315
Human FASTK Gene cDNA Clone (full-length ORF Clone)HG10737-M$115
Human FASTK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10737-M-F$315
Human FASTK Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10737-M-N$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10737-NF$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10737-NH$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10737-NM$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10737-NY$315
Human FASTK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10737-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10737-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"