Quick Order

Text Size:AAA

Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IRAK4cDNA Clone Product Information
cDNA Size:1383
cDNA Description:ORF Clone of Homo sapiens interleukin-1 receptor-associated kinase 4 DNA.
Gene Synonym:IPD1, REN64, NY-REN-64, IRAK4
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10735-ACG$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10735-ACR$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10735-ANG$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10735-ANR$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10735-CF$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10735-CH$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10735-CM$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10735-CY$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone)HG10735-M$95
Human IRAK4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10735-M-F$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10735-M-N$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10735-NF$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10735-NH$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10735-NM$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10735-NY$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10735-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Interleukin-1 receptor-associated kinase 4, also known as Renal carcinoma antigen NY-REN-64, IRAK-4 and IRAK4, is a member of the protein kinase superfamily, TKL Ser/Thr protein kinase family and Pelle subfamily. IRAK4 contains one death domain and one protein kinase domain. IRAK4 is required for the efficient recruitment of IRAK1 to the IL-1 receptor complex following IL-1 engagement, triggering intracellular signaling cascades leading to transcriptional up-regulation and mRNA stabilization. It also phosphorylates IRAK1. A member of the IL-1 receptor (IL-1R)-associated kinase (IRAK) family, IRAK4, has been shown to play an essential role in Toll-like receptor (TLR)-mediated signaling. IL-1-mediated IRAK4 kinase activity in T cells is essential for induction of IL-23R expression, Th17 differentiation, and autoimmune disease. Pharmacological blocking of IRAK4 kinase activity will retain some levels of host defence, while reducing the levels and duration of inflammatory responses, which should provide beneficial therapies for sepsis and chronic inflammatory diseases. Defects in IRAK4 are the cause of recurrent isolated invasive pneumococcal disease type 1 (IPD1) which is defined as two episodes of IPD occurring at least 1 month apart, whether caused by the same or different serotypes or strains. Recurrent IPD occurs in at least 2% of patients in most series, making IPD the most important known risk factor for subsequent IPD. Defects in IRAK4 are also the cause of IRAK4 deficiency which causes extracellular pyogenic bacterial and fungal infections in otherwise healthy children.

  • Strelow,A. et al., 2003, FEBS Lett. 547 (1-3):157-61.
  • Kim,T.W. et al., 2007, J Exp Med. 204 (5):1025-36.
  • Trumstedt,C. et al., 2007, J Leukoc Biol. 81 (6):1591-8.
  • Li,X. et al., 2008, Eur J Immunol. 38 (3):614-8.
  • Staschke,K.A. et al., 2009, J Immunol. 183 (1): 568-77. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items