After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DDR1cDNA Clone Product Information
Gene_bank_ref_id:NM_013993.2
cDNA Size:2742
cDNA Description:ORF Clone of Homo sapiens discoidin domain receptor tyrosine kinase 1 , transcript variant 2 DNA.
Gene Synonym:CAK, DDR, NEP, PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, NTRK4, PTK3A, DDR1
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10730-ACG$475
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10730-ACR$475
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10730-CF$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10730-CH$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10730-CM$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10730-CY$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10730-M$145
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10730-M-F$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10730-NF$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10730-NH$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10730-NM$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10730-NY$445
Human DDR1 Kinase / MCK10 / CD167 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10730-UT$445
 Learn more about expression Vectors
Receptor Tyrosine Kinase (RTK) Related Products
Product nameProduct name
Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Cynomolgus EphB1 / EPHT2 Protein (His Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human KIT / c-KIT / CD117 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinCanine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman IGF1R / CD221 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman Axl Kinase Protein (His Tag)Human MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer Protein GST TagHuman MERTK / Mer ProteinHuman MERTK / Mer(aa 578-872) ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human Tie1 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD140b / PDGFRB Protein (His Tag)Human PDGFRB / PDGFR-1 / CD140b ProteinHuman FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Human PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Human PDGFRa / CD140a ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human c-MET / HGFR Protein (His Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human Tie2 / CD202b Protein (His & Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Human TrkA / NTRK1 Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human CD136 / MST1R Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Human c-KIT / CD117 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Human RET Kinase Protein (His Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse Axl Kinase Protein (His & Fc Tag)Mouse Axl Kinase Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFR2 / CD332 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Mouse TrkA / NTRK1 Protein (His Tag)Canine c-MET / HGFR Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag) Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus DDR2 Kinase / CD167b Protein (Fc Tag)Cynomolgus DDR2 Kinase / CD167b Protein (His Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus / Rhesus PDGFRB / CD140b Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)
Background

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 10 (MCK10), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK10/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK10/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.

References
  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.
  • Size / Price
    Catalog:HG10730-UT
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"