After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CSNK1G3 transcript variant 3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSNK1G3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001044722.1
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens casein kinase 1, gamma 3, transcript variant 3.
Gene Synonym:CSNK1G3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSNK1G3
Restriction Site:KpnI + XbaI (6.1kb + 1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1G3 Gene Plasmid Map
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human CSNK1G3 transcript variant 3 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG10719-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"