After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TH cDNA Clone Product Information
Gene_bank_ref_id:NM_000360.3
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine hydroxylase, transcript variant 2.
Gene Synonym:TYH, TH
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmid on other vectors
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-GFPSpark tagHG10684-ACG$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10684-ACR$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-GFPSpark tagHG10684-ANG$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10684-ANR$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Flag tagHG10684-CF$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-His tagHG10684-CH$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Myc tagHG10684-CM$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-HA tagHG10684-CY$295
Human Tyrosine Hydroxylase transcript variant 2 Gene cDNA clone plasmidHG10684-M$195
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-Flag tagHG10684-NF$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-His tagHG10684-NH$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-Myc tagHG10684-NM$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-HA tagHG10684-NY$295
Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmidHG10684-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Tyrosine hydroxylase (TH) is a rate-limiting enzyme in catecholamine synthesis. Tyrosine hydroxylase activity is modulated by protein-protein interactions with enzymes in the same pathway or the tetrahydrobiopterin pathway, structural proteins considered to be chaperones that mediate the neuron's oxidative state. It is phosphorylated at serine (Ser) residues Ser8, Ser19, Ser31 and Ser40 in vitro. The phosphorylation of tyrosine hydroxylase at Ser19 or Ser8 has no direct effect on tyrosine hydroxylase activity. As tyrosine hydroxylase (TH) catalyses the formation of L-DOPA, the rate-limiting step in the biosynthesis of DA, the Parkinson's disease (PD) can be considered as a TH-deficiency syndrome of the striatum. A direct pathogenetic role of TH has also been suggested, as the enzyme is a source of reactive oxygen species (ROS) in vitro and a target for radical-mediated oxidative injury. Recently, it has been demonstrated that L-DOPA is effectively oxidized by mammalian Tyrosine hydroxylase in vitro, possibly contributing to the cytotoxic effects of DOPA.

References
  • Daubner SC, et al. (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 508(1): 1-12.
  • Dunkley PR, et al. (2004) Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem. 91(5): 1025-43.
  • Haavik J, et al. (1998) Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol. 16(3): 285-309.
  • Size / Price
    Catalog: HG10684-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"