Quick Order

Human MAPKAPK3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPKAPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_004635.3
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase-activated protein kinase 3.
Gene Synonym:3PK, MAPKAP3, MAPKAPK3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAPKAPK3
Restriction Site:KpnI + XbaI (6.1kb + 1.15kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

References
  • McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.
  • Tanoue, T. et al., 2001, EMBO J. 20: 466-479.
  • Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.
  • Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.
  • Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.
  • Size / Price
    Catalog: HG10683-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"