Quick Order

Human MAP2K2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAP2K2 cDNA Clone Product Information
Gene_bank_ref_id:NM_030662.3
RefSeq ORF Size:1203bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 2.
Gene Synonym:MEK2, MKK2, MAPKK2, PRKMK2, FLJ26075, MAP2K2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

References
  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    Catalog: HG10678-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"