After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human chk1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHEK1cDNA Clone Product Information
cDNA Size:1431
cDNA Description:ORF Clone of Homo sapiens CHK1 checkpoint homolog (S. pombe) DNA.
Gene Synonym:CHK1, CHEK1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.

  • Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.
  • Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.
  • Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.
  • Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human chk1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items