After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MMP-1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002421.3
RefSeq ORF Size:1410bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 1 (interstitial collagenase).
Gene Synonym:CLG, CLGN
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MMP1
Restriction Site:KpnI + NotI (6.1kb + 1.41kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 648 A>G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MMP1 Gene Plasmid Map
Human MMP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

MMP1, also known as MMP-1, contains 4 hemopexin-like domains and is a member of the matrix metalloproteinase (MMP) family. Matrix metalloproteases, also called matrixins, are zinc-dependent endopeptidases that are the major proteases involved in ECM degradation. MMPs are capable of degrading a wide range of extracellular molecules and a number of bioactive molecules. MMP activity is regulated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMPs play a central role in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defences. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Tumour metastasis is a multistep process involving the dessemination of tumor cells from the primary tumor to secondarys at a distant organ or tissue. One of the first steps in metastasis is the degradation of the basement membrane, a process in which MMPs have been implicated. MMPs are secreted by tumor cells themselves or by surrounding stromal cells stimulated by the nearby tumor. Numerous studies have linked altered MMP expression in different human cancers with poor disease prognosis. MMP-1, -2, -3, -7, -9, -13 and -14 all have elevated expression in primary tumors and/or metastases. MMP-1 cleaves collagens of types I, II, and III at one site in the helical domain. It also cleaves collagens of types VII and X. In case of HIV infection, MMP1 interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.

References
  • Gross J, et al. (1962) Collagenolytic Activity in Amphibian Tissues: A Tissue Culture Assay. Proceedings of the National Academy of Sciences. 48(6):1014-22.
  • Pendas, et al. (1996) Fine Physical Mapping of the Human Matrix Metalloproteinase Genes Clustered on Chromosome 11q22.3. Genomics. 37(2):266-8.
  • Brinckerhoff C E, et al. (1987) Molecular cloning of human synovial cell collagenase and selection of a single gene from genomic DNA. Journal of Clinical Investigation. 79(2):542-6.
  • Size / Price
    Catalog: HG10532-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"