After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LBP natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LBP cDNA Clone Product Information
Gene_bank_ref_id:NM_004139.2
RefSeq ORF Size:1446bp
cDNA Description:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein.
Gene Synonym:MGC22233
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-LBP
Restriction Site:KpnI + XbaI (6.1kb + 1.45kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 612G>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human LBP Gene Plasmid Map
Human LBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

References
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catalog: HG10526-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"