After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SPG21 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SPG21 cDNA Clone Product Information
Gene_bank_ref_id:NM_016630.3
RefSeq ORF Size:927bp
cDNA Description:Full length Clone DNA of Homo sapiens spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1.
Gene Synonym:MAST, ACP33, GL010, BM-019, MASPARDIN
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SPG21
Restriction Site:KpnI + XbaI (6.1kb + 0.93kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

References
  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    Catalog: HG10522-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"