Quick Order

Human ADAM15 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
ADAM15cDNA Clone Product Information
Gene Bank Ref.ID:NM_207191.1
cDNA Size:2319
cDNA Description:ORF Clone of Homo sapiens ADAM metallopeptidase domain 15 DNA.
Gene Synonym:MDC15
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

ADAM15, also known as Metargidin, is a type I transmembrane glycoprotein belonging to the ADAM (A Disintegrin and Metalloprotease Domain) family of proteins and is widely expressed in different tissues and cell types. Members of this family contain an amino-terminal metalloprotease domain followed by a disintegrin domain, a cysteine-rich region and a membrane proximal EGF-like domain. The disintegrin domain of ADAM15/metargidin contains an RGD tripeptide sequence, suggesting that it may potentially interact with the integrin family of proteins. ADAM15 is a transmembrane multi-domain proteins implicated in proteolysis, cell-cell and cell-matrix interactions in various disease conditions. There is also evidence supporting a role for ADAM15 in angiogenesis and angioinvasion of tumor cells, which are critical for unrestrained tumor growth and metastatic spread. Given its diverse functions, ADAM15 may represent a pivotal regulatory component of tumor progression, an important target for therapeutic intervention, or emerge as a biomarker of disease progression.

Reference
  • Poghosyan Z, et al. (2002) Phosphorylation-dependent interactions between ADAM15 cytoplasmic domain and Src family protein-tyrosine kinases. J Biol Chem. 277(7): 4999-5007.
  • Carl-McGrath S, et al. (2005) The disintegrin-metalloproteinases ADAM9, ADAM12, and ADAM15 are upregulated in gastric cancer. Int J Oncol. 26(1): 17-24.
  • Najy AJ, et al. (2008) ADAM15 supports prostate cancer metastasis by modulating tumor cell-endothelial cell interaction. Cancer Res. 68(4): 1092-9.
  • Maretzky T, et al. (2009) Characterization of the catalytic activity of the membrane-anchored metalloproteinase ADAM15 in cell-based assays. Biochem J. 420(1): 105-13.
  • Size / Price
    Catalog:HG10517-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"