Quick Order

Human CST5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST5cDNA Clone Product Information
Gene_bank_ref_id:NM_001900.4
cDNA Size:429
cDNA Description:ORF Clone of Homo sapiens cystatin D DNA.
Gene Synonym:CST5, MGC71922
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin superfamily members are of three major types, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. As a member of type 2 cystatin, cystatin D is a single-domain protein and also has cysteine residues that form disulfide bridges. In contrast with the wider distribution of all the other family 2 cystatins, cystatin D is tissue-restricted expressed and has been found only in saliva and tears. and meanwhile, it displays an inhibition profile with a preferential inhibition on cathepsin S, H, L. Although the exact functions are largely unknown, it has reported that cystatin D is involved in the inhibition of virus replication and apoptosis.

Size / Price
Catalog:HG10506-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"