After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TPSB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPSB2cDNA Clone Product Information
Gene_bank_ref_id:NM_024164.5
cDNA Size:828
cDNA Description:ORF Clone of Homo sapiens tryptase beta 2 DNA.
Gene Synonym:TPS2, TPSB1, tryptaseC
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1, and fall into two groups, α and β. β-tryptases appear to be the main isoenzymes expressed in mast cells, whereas α-tryptases predominate in basophils. Tryptase is unique in two respects: it is enzymatically active only as a heparin-stabilized tetramer, and it is resistant to all known endogenous proteinase inhibitors because of the unique arrangement of the active sites. Additionally, tryptase family genes have an intron immediately upstream of the initiator codon which separates the transcription initiation site from protein coding sequence, and this feature is characteristic of tryptases. β-tryptases existing in three isoforms (β1,β2,β3) are released in secretory granules, and have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. It has been reported that β-tryptase selectively cleaves ASM-derived eotaxin and RANTES and abrogates their chemotactic activities.

References
  • Miller, J.S. et al., 1990, J. Clin. Invest. 86: 864-870.
  • Pereira, P.J. et al., 1998, Nature. 392: 306-311.
  • Pallaoro, M.et al., 1999, J. Biol. Chem. 274: 3355-3362.
  • Pang, L. et al., 2006, J. Immunol. 176: 3788-3795.
  • Size / Price
    Catalog:HG10505-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"