Quick Order

Text Size:AAA

Human CCL18 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL18 cDNA Clone Product Information
Gene_bank_ref_id:NM_002988.2
RefSeq ORF Size:270bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated).
Gene Synonym:CKb7, PARC, AMAC1, DCCK1, MIP-4, AMAC-1, DC-CK1, SCYA18
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: HG10502-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"