Quick Order

Human CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPB1cDNA Clone Product Information
Gene_bank_ref_id:NM_021804.1
cDNA Size:1254
cDNA Description:ORF Clone of Homo sapiens carboxypeptidase B1 (tissue) DNA.
Gene Synonym:PASP, PCPB, DKFZp779K1333
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Human Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

References
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catalog:HG10501-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"