Quick Order

Human Integrin alpha M natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITGAM cDNA Clone Product Information
Gene_bank_ref_id:NM_000632.3
RefSeq ORF Size:3459bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha M (complement component 3 receptor 3 subunit).
Gene Synonym:CR3A, MO1A, CD11B, MAC-1, MAC1A, SLEB6, Â, MGC117044, ITGAM
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ITGAM
Restriction Site:KpnI + XbaI (6.1kb + 3.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGAM Gene Plasmid Map
Human Integrin alpha M natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG10494-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"