Quick Order

Human ADAMTS1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADAMTS1 cDNA Clone Product Information
Gene_bank_ref_id:NM_006988.3
RefSeq ORF Size:2904bp
cDNA Description:Full length Clone DNA of Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 1.
Gene Synonym:C3-C5, METH1, KIAA1346, ADAMTS1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ADAMTS1
Restriction Site:KpnI + XbaI (6.1kb + 2.9kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 582 C/A, 600 C/G and 1500 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG10493-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"