After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SELPLG / PSGL-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELPLGcDNA Clone Product Information
Gene_bank_ref_id:NM_003006.3
cDNA Size:1209
cDNA Description:ORF Clone of Homo sapiens selectin P ligand DNA.
Gene Synonym:CLA, CD162, PSGL1, PSGL-1, SELPLG
Species:Human
Vector:pCMV3-untagged
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human SELPLG / PSGL-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Background

P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

References

1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"