After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA2cDNA Clone Product Information
Gene_bank_ref_id:NM_000067.2
cDNA Size:783
cDNA Description:ORF Clone of Homo sapiens carbonic anhydrase II DNA.
Gene Synonym:CAII, Car2, CA-II, CA2
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 562 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10478-ACG$325
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10478-ACR$325
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10478-ANG$325
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10478-ANR$325
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10478-CF$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10478-CH$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10478-CM$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10478-CY$295
Human CA II Gene cDNA Clone (full-length ORF Clone)HG10478-M$95
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10478-M-F$295
Human CA II Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10478-M-N$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10478-NF$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10478-NH$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10478-NM$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10478-NY$295
Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10478-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catalog:HG10478-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human CA II Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"