After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCL21 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL21 cDNA Clone Product Information
Gene_bank_ref_id:NM_002989.2
RefSeq ORF Size:405bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 21.
Gene Synonym:ECL, SLC, CKb9, TCA4, 6Ckine, SCYA21, MGC34555, CCL21
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCL21
Restriction Site:KpnI + XbaI (6.1kb + 0.41kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCL21 Gene Plasmid Map
Human CCL21 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Background

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 21(CCL21), also known as 6Ckine, exodus-2, and secondary lymphoid-tissue chemokine(SLC), is a small cytokine belonging to the C-C chemokine family. CCL21 takes its name 6Ckine for its consititutively six conserved cysteine residues but not four cysteines typical to chemokines. CCL21 has function in ininducing vigorous calcium migrations and chemotactic responses.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Yoshida R, et al. (1998) Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. The journal of biological chemistry. 273: 7118-22.
  • Size / Price
    Catalog: HG10477-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"