After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CCL14 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL14 cDNA Clone Product Information
NCBI RefSeq:NM_032963.2
RefSeq ORF Size:282bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 14.
Gene Synonym:CC-1, CC-3, CKb1, MCIF, NCC2, SY14, HCC-1, HCC-3, NCC-2, SCYL2, SCYA14, CCL14
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCL14
Restriction Site:HindIII + XbaI (6.1kb + 0.28kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCL14 Gene Plasmid Map
Human CCL14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Knappe S, et al. (1996) HCC-1, a novel chemokine from human plasma. J Exp Med. 183: 295-9.
  • Naruse, et al. (1996) A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2. Genomics. 34: 236-40.
  •  

    CCL14/HCC-1/HCC-3 related areas, pathways, and other information

    Size / Price
    Catalog: HG10476-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"