Quick Order

Text Size:AAA

Human RTN4R / NOGOR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RTN4RcDNA Clone Product Information
Gene_bank_ref_id:NM_023004.5
cDNA Size:1422
cDNA Description:ORF Clone of Homo sapiens reticulon 4 receptor DNA.
Gene Synonym:NGR, NOGOR, RTN4R
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Size / Price
Catalog:HG10466-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 Business days
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"