After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA13cDNA Clone Product Information
Gene_bank_ref_id:NM_198584.2
cDNA Size:789
cDNA Description:ORF Clone of Homo sapiens carbonic anhydrase XIII DNA.
Gene Synonym:CAXIII, FLJ37995, MGC59868, CA13
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10461-ACG$325
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10461-ACR$325
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10461-ANG$325
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10461-ANR$325
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10461-CF$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10461-CH$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10461-CM$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10461-CY$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone)HG10461-M$95
Human CA XIII Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10461-M-F$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10461-M-N$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10461-NF$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10461-NH$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10461-NM$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10461-NY$295
Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10461-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Catalog:HG10461-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human CA XIII Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"