Quick Order

Text Size:AAA

Human CA XIV natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CA14 cDNA Clone Product Information
Gene_bank_ref_id:NM_012113.1
RefSeq ORF Size:1014bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase XIV.
Gene Synonym:CA14
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CA14
Restriction Site:KpnI + XbaI (6.1kb + 1.01kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CA14 Gene Plasmid Map
Human CA XIV Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. CAXIV is a member of CA family that showed an overall similarity of 29–46% to other active CA isozymes. The highest percentage similarity was with a transmembrane CA isoform, CAXII. The CAXIV was found high concentrations in human heart, brain, liver, and skeletal muscle but lower in the colon, small intestine, urinary bladder, and kidney. No CAXIV mRNA was seen in the salivary gland and pancreas. CAXIV is a likely candidate for the extracellular CA postulated to have an important role in modulating excitatory synaptic transmission in brain.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Parkkila S, et al. (2001) Expression of membrane-associated carbonic anhydrase XIV on neurons and axons in mouse and human brain. PNAS. 98(4): 1918-23.
  • Size / Price
    Catalog: HG10458-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"