Quick Order

Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANXA5cDNA Clone Product Information
cDNA Size:963
cDNA Description:ORF Clone of Homo sapiens annexin A5 DNA.
Gene Synonym:PP4, ANX5, ENX2, ANXA5
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10448-ACG$325
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10448-ACR$325
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10448-ANG$325
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10448-ANR$325
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10448-CF$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10448-CH$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10448-CM$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10448-CY$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone)HG10448-M$95
Human ANXA5 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10448-M-F$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10448-M-N$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10448-NF$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10448-NH$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10448-NM$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10448-NY$295
Human ANXA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10448-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items