Quick Order

Text Size:AAA

Human Angiogenin natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANG cDNA Clone Product Information
Gene_bank_ref_id:NM_001097577.2
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens angiogenin, ribonuclease, RNase A family, 5.
Gene Synonym:ALS9, HEL168, RNASE4, RNASE5, MGC22466, MGC71966, ANG
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-Ang
Restriction Site:KpnI + XbaI (6.1kb + 0.44kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ANG Gene Plasmid Map
Human Angiogenin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: HG10441-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"